Protein structure | Chemistry homework help

  

CHM-530: Protein Structure Prediction

Introduction

In a postgenomic world, the heavy lifting has turned to protein-structure prediction from sequence (DNA or translated amino acid). There is a plethora of tools available to the biochemist to do just that. While these are still just predictive tools, they are an invaluable asset for understanding molecular interactions within the cell. In this assignment, you will translate a given DNA sequence and then put it through a secondary structure prediction tool. Additionally, you will be asked to explain basic aspects of translation and the types of secondary structure that the prediction tool searches for in the amino acid sequence. Use the Lehninger Principles of Biochemistry textbook or other online sources to answer the questions. 

Procedure

1. Starting with the DNA sequence listed below, go to the ExPASy Tool (https://web.expasy.org/translate/). 

a. Cut and paste the sequence into the translate tool. The output shows different open reading frames. 

b. There will be six frames giving all possible protein sequences for the offered DNA sequence. Select the longest continuous, red-highlighted sequence (open reading frame), and click on the red “M” to gain access to the amino acid sequence. Be sure it says that there are 503 amino acids. 

c. Copy the single letter amino acid code, which should start with M, in FASTA format, and paste it into the “Protein Structure Report” below. Make sure only open reading frame amino acid information is copied and pasted into this worksheet. Answer the question associated with Part 1.

2. Take that single letter amino acid code and do a secondary structure prediction on the sequence using the SCRATCH Protein Predictor website. (http://scratch.proteomics.ics.uci.edu/). 

a. Paste in your converted amino acid sequence, and select the prediction option SSpro8: Secondary Structure (8 Class). You will be asked about the output of that selection. You can also choose whatever predictor options you want for your own curiousity. You will receive an e-mail with your results, which may take up to 30 minutes. 

The DNA sequence is on the next page

  

TGCTGACCCTATGATGTATCCTATGGTCATTTATTAAGATGTTATCCTAA
AAAGTATATAACGATTTATTATAGTGTGATAGTAATACCAGAACGAGAAA
TTAGAAAATTGTAAAAAAAGAATTTTAAAATATTATGCGGCTACTTTTCC
TACAGTTTCTGCAATTTTTGCTTCTTCTTCAGCAAATGCGCATAGCATTG
CTTCTATGTCGGCATATCCTTCTGCTTTTGCTGTCATTGCTATTTTGTTG
TATGTGGATATGTGCTCCTCTCCCTCTTTAGTAGCGAAATCAGATAGTAA
CTTCTTTACCTTTAATTCGGTGGCTACTTTTCCTACAGTTTCTGCAATTT
TTGCTTCTTCTTCAGCAAATGCGCATAGCATTGCTTCTATGTCGGCATAT
CCTTCTGCTTTTGCTGTCATTGCTATTTTGTTGTATGTGGATATGTGCTC
CTCTCCCTCTTTTATTGAGAATTCTTCTAATATTTTTTCTACTTTACTGG
ATATCATAGGTATTCGTAATGAATAATCGGAAGGCAAATATATAAGCATT
TGTTAAGCTTTTTTAATACTAAATATAATTAGCATTTTTGTATTTCAACA
AAGTTTGAGATTTTTGTATTACGGAACTAAAAATCCTCTAAAAAACTTAA
CTTGTATATAAAATTCTTTCGTATAATTTCTTTGCCTCTTCATACTTCTC
CTTTGATTTGGTTTCTAATTCGTTCTTCCTTTCAGGAAGTTTTTCAGCTA
ATAGTTTTGAGAGCATATAAACTGTAGCTGTAAGCATAAATTTCTCTTTT
AATTGCTCACTTTCCTTTTTATTTAACTCTTCGAACCAATTGGTTATATA
TTCTAACCCTAAATACTTTATCATTTTCTCTAATATTCCCCTAGCATGAC
CCAATTCAACTAAGGCTTTTTCCCTAATTTTTTCAGATTCTTCCTTTTTA
TTAACCTCCTCCAGCTTTTGAGAGGAGAACAATAGTAATAAATGGTCTTC
GGAGTTAGCCATAAAAAGCTCTTTTAATCCTATTTCAGTCTGTGTCCCCT
TCATCACCTTTAAATTGTATTCATAGCTAATATACTCTTGTTAAAATAAT
GATGACTAACTCCAATACTGACCAATGATGTCGTAACCCGAAACTGAATA
AAAGTAAAATCCTTCCCTACTGAGAATATTTGTATGATAACCTCAAAAAG
AATGAAAGCCCTTGAAATTAATAGCGAAGCATTAGGCGTGCCAACATTAC
TCTTGATGGAAAACGCAGGGAGAAGTGTAAAGGATGAAATAATGAAAAGA
CTGAATTTGGACTATTCTAAAAAGGTTGTAGTATTTGCAGGAACTGGTGG
AAAAGGAGGAGACGGATTAGTAGTAGCAAGGCACCTTGCCTCGGAAGGGT
CAGAGGTTCATGTTTTACTTTTAGGCGAGAACAAACATCCGGACGCAATC
ATTAACTTGAATGCAATATATGAAATGGATTATTCTATTAGAGAAGTTAA
ACTGATAAAAGATACTGACGAATTGCAACCAGTTAAAGCTGACGTGCTTA
TAGATGCCATGTTAGGCACGGGATTTTCTGGTAAAGTTAGAGAACCATTT
AGAACAGCTATTAGAGTATTTAATCAGAGCTCTGGTTTTAAGGTTTCTAT
AGATATACCCTCTGGGATAAATGCAGACGATGAAGAACAGCAGGGAGAAC
ACGTTATTCCCGACCTAATAGTCACCTTTCATGATCTTAAGCCAGGCTTA
AAAAAATTTGAGAGTAAAGTGGTCGTCAAGAAAATAGGTATTCCTAAAGA
GGCTGAAATATATGTTGGTCCCGGTGATGTCATTGTCAATGTGAAGAAAA
GAGAGTATAACACAAAGAAAGGAGATAATGGAAGAGTTTTGATCATTGGA
GGGAATTTTACATTTAGTGGAGCCCCAACTCTATCTGCTTTGGGAGCCTT
AAGGACGGGAGCAGATCTGGTATATGTCGCATCTCCAGAGGAGACAGCTA
AGGTCATCTCTAGCTTTTCCCCTGACCTTATATCTATTAAGCTTAAGGGA
AAGAATATATCTACAGACAATTTGGATGAGCTAAAACCATGGATTGATAA
AGCTGACGTCGTAGTTGTAGGACCTGGTATGGGACAAGAAAGGGAAACTG
TAGATGCTTCCATAGAGATAGTTAGATATCTGAAAGCAAAGAATAAACCT
TCAGTCATAGATGCTGATGCGTTAAAATCAGTGGCAGGTATGGAATTATT
CCCGAATGCAGTAATAACTCCTCATGCAGGAGAATTTAAGATATATTCAG
GGGTTCAGCCTGATTCGAACATGAGAAAAAGAATTGAGCAAGTGAAGGAG
TGCTCACTGAAATGTAATTGTGTAGTACTCCTTAAGGGTTATGTTGATAT
CATAGCAGAAAAGGAAGAATTTAAACTTAATAAGACAGGAAATCCTGGAA
TGGCAGTTGGCGGTACTGGGGATACATTGACAGGAATAATTGCCTCATTT
ATGGCTCAAAAACTATCTCCATTCACTTCTGCTTACTTGGGAGCATTCGT
TAATGGTTTAGCAGGGTCTATAGCATATGAAAAACTTGGCGCACATCTAG
TTGCAACAGATATAATAGAAAACATTCCTAAGGTAATTAATGAACCTTTA
GAAGTGTTCAAGAAAAAAGTGTACAAAAGGATTTTAGATACTTAGGTTTT
ACCCCTAATTCTTTTAATAATCTCAAGTGATTTGTTTGCATGTTCTTCTG
CATTTCCTAGACCGCTCAATACCTCTATAATTTTTCCGTTTTCGTCTATG
ATAAAGGTTACTCTCTGAGCACTTGAGCCTTTCTCGTTTAGAACACCGTA
TAATTTAGCTATTTGTTTATTTGAGTCAGAAACTATAGGAAATCTGGCAC
CGCATTTGTCTGCAAAACTCTTTTGAGTTGAAACTGTATCAACACTAACA
CCTATAACTTCAGCATTTAACTGTTTAAATTGGTCATAAAGTTGTCCAAA
TTTTATGGTCTCTCTAGTACAACCAGGTGTAAACGCCTTAGGATAGAAAT
ATAGTACAACTACAGATTTGCCTCTATATGAAGATAGTTTCAATTTTCCT
ATAGTTGAATCTCCTTCAAAATCAGGAGCTTCATTTCCTTTTTCTAAAGC
CATAGATTATCTGATATAAATATATTCAGTTATGGTTTTTAACCTCTTTT
TCGCTTATGCCTTACA

CHM-530: Protein Structure Report

Name_____________________________

Part 1: Translation

Paste the single letter amino acid code in the box below. (10 points)

Text Box: single letter amino acid code

Questions

1. Why are there six different frames from a single DNA sequence? (5 points)

2. Why does each red-highlighted region begin with “M”? (5 points)

Part 2

Paste the Predicted Secondary Structure in the box below. Do not paste amino acid code. (10 points)

Text Box: Predicted Secondary Structure (8 Class):

1. What do the following secondary structure designations mean? What specifically is the difference between E and B? Use “SCRATCH; A Quick Description” (http://scratch.proteomics.ics.uci.edu/explanation.html) as a reference. (7.5 points)

H: 

G: 

I: 

E: 

B: 

T: 

S:

C: 

2. From the e-mailed results from SCRATCH, what type and amount of secondary structure did the prediction tool suggest? Specifically, explain how much alpha helix and beta sheet (bridge) was found. (7.5 points)

Calculate your paper price
Pages (550 words)
Approximate price: -

Why Choose Us

Quality Papers

We value our clients. For this reason, we ensure that each paper is written carefully as per the instructions provided by the client. Our editing team also checks all the papers to ensure that they have been completed as per the expectations.

Professional Academic Writers

Over the years, our Acme Homework has managed to secure the most qualified, reliable and experienced team of writers. The company has also ensured continued training and development of the team members to ensure that it keep up with the rising Academic Trends.

Affordable Prices

Our prices are fairly priced in such a way that ensures affordability. Additionally, you can get a free price quotation by clicking on the "Place Order" button.

On-Time delivery

We pay strict attention on deadlines. For this reason, we ensure that all papers are submitted earlier, even before the deadline indicated by the customer. For this reason, the client can go through the work and review everything.

100% Originality

At Essay USA, all papers are plagiarism-free as they are written from scratch. We have taken strict measures to ensure that there is no similarity on all papers and that citations are included as per the standards set.

Customer Support 24/7

Our support team is readily available to provide any guidance/help on our platform at any time of the day/night. Feel free to contact us via the Chat window or support email: support@acmehomework.com.

Try it now!

Calculate the price of your order

We'll send you the first draft for approval by at
Total price:
$0.00

How it works?

Follow these simple steps to get your paper done

Place your order

Fill in the order form and provide all details of your assignment.

Proceed with the payment

Choose the payment system that suits you most.

Receive the final file

Once your paper is ready, we will email it to you.

Our Services

Essay USA has stood as the world’s leading custom essay writing services providers. Once you enter all the details in the order form under the place order button, the rest is up to us.

Essays

Essay Writing Services

At Essay USA, we prioritize on all aspects that bring about a good grade such as impeccable grammar, proper structure, zero-plagiarism and conformance to guidelines. Our experienced team of writers will help you completed your essays and other assignments.

Admissions

Admission and Business Papers

Be assured that you’ll definitely get accepted to the Master’s level program at any university once you enter all the details in the order form. We won’t leave you here; we will also help you secure a good position in your aspired workplace by creating an outstanding resume or portfolio once you place an order.

Editing

Editing and Proofreading

Our skilled editing and writing team will help you restructure you paper, paraphrase, correct grammar and replace plagiarized sections on your paper just on time. The service is geared toward eliminating any mistakes and rather enhancing better quality.

Coursework

Technical papers

We have writers in almost all fields including the most technical fields. You don’t have to worry about the complexity of your paper. Simply enter as much details as possible in the place order section.